Stem-loop sequence pxy-mir-283

AccessionMI0027380 (change log)
DescriptionPlutella xylostella miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   uaa             a        uua 
5'    auaucagcuggua uucugggg   g
      ||||||||||||| ||||||||    
3'    uaugguugaucgu gagacccc   a
   acc             -        cuc 
Get sequence
Deep sequencing
12 reads, 300 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_184: 1774-1830 [+]
intergenic
Database links

Mature sequence pxy-miR-283

Accession MIMAT0033786
Sequence

37 - 

cagagugcuaguugguaucca

 - 57

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1