Stem-loop sequence pxy-mir-306-2

AccessionMI0027382 (change log)
DescriptionPlutella xylostella miR-306-2 stem-loop
Gene family MIPF0000313; mir-306
Literature search

2 open access papers mention pxy-mir-306-2
(8 sentences)

Stem-loop
   uaa  c        -ucc         gu a       uggu 
5'    cg agguccau    agguacuag  g cucugag    u
      || ||||||||    |||||||||  | |||||||    g
3'    gc ucuaggua    uccgugguc  u gagacuc    a
   aug  -        caac         ug c       uaua 
Get sequence
Deep sequencing
365 reads, 1e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_287: 24523-24607 [-]
intergenic
scaffold_32: 1411767-1411851 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-306-2
pxy-mir-9b-1scaffold_287: 26021-26126 [-]
pxy-mir-306-2scaffold_287: 24523-24607 [-]
Database links

Mature sequence pxy-miR-306

Accession MIMAT0033787
Sequence

16 - 

ccagguacuaggugacucuga

 - 36

Get sequence
Deep sequencing622 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1