Stem-loop sequence pxy-mir-3286

AccessionMI0027383 (change log)
DescriptionPlutella xylostella miR-3286 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   uaa     -  -aa  c         -u   u        cua    c 
5'    gaagc cc   aa aacuauugg  cac gcacagga   guaa a
      ||||| ||   || |||||||||  ||| ||||||||   |||| c
3'    cuucg gg   uu uugauaauc  gug cguguucu   uauu a
   aaa     u  gug  a         uu   -        -ca    u 
Get sequence
Deep sequencing
5 reads, 125 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_347: 394559-394652 [-]
intergenic
Database links

Mature sequence pxy-miR-3286

Accession MIMAT0033788
Sequence

16 - 

aacuauuggucacugcacaggac

 - 38

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1