Stem-loop sequence pxy-mir-8536b

AccessionMI0027384 (change log)
DescriptionPlutella xylostella miR-8536b stem-loop
Gene family MIPF0002030; mir-8536
Stem-loop
   uaa        u  uc                  a   -a  g 
5'    ucugacau ag  agugacauagcugggaua guu  gu u
      |||||||| ||  |||||||||||||||||| |||  || g
3'    ggacugug uc  ucacuguaucgacucuau caa  ua a
   uaa        c  ua                  c   ag  a 
Get sequence
Deep sequencing
91 reads, 2.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_50: 599933-600020 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8536b
pxy-mir-8536bscaffold_50: 599933-600020 [+]
pxy-mir-8536ascaffold_50: 599934-600019 [-]
Database links

Mature sequence pxy-miR-8536b-5p

Accession MIMAT0033789
Sequence

18 - 

gugacauagcugggauaaguu

 - 38

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8536b-3p

Accession MIMAT0033790
Sequence

53 - 

ccuaucucagcuaugucacua

 - 73

Get sequence
Deep sequencing77 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1