Stem-loop sequence pxy-mir-8537-2

AccessionMI0027385 (change log)
DescriptionPlutella xylostella miR-8537-2 stem-loop
Stem-loop
   uac                      uc   u  c 
5'    cgucgcuguuauugcaaaaugu  uau uu g
      ||||||||||||||||||||||  ||| ||  
3'    gcagcgacaauaacguuuuaca  aua ag a
   aua                      ga   c  u 
Get sequence
Deep sequencing
1 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_81: 327721-327790 [-]
intergenic
Database links

Mature sequence pxy-miR-8537-5p

Accession MIMAT0033721
Sequence

8 - 

gcuguuauugcaaaauguucua

 - 29

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8537-3p

Accession MIMAT0033792
Sequence

44 - 

agacauuuugcaauaacagcga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1