Stem-loop sequence pxy-mir-8538

AccessionMI0027387 (change log)
DescriptionPlutella xylostella miR-8538 stem-loop
Stem-loop
   uaucaaaaucuucaagaucuau         a            -----ccu    uac 
5'                       aucgaccaa auuaauaacuau        uccu   u
                         ||||||||| ||||||||||||        ||||   u
3'                       ugguugguu uaauuauugaua        agga   a
   -------------------auu         c            auacauac    uuc 
Get sequence
Deep sequencing
17 reads, 425 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_6: 939783-939879 [+]
intergenic
Database links

Mature sequence pxy-miR-8538

Accession MIMAT0033795
Sequence

73 - 

auaguuauuaaucuugguuggu

 - 94

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1