Stem-loop sequence pxy-mir-8539-2

AccessionMI0027389 (change log)
DescriptionPlutella xylostella miR-8539-2 stem-loop
Gene family MIPF0002084; mir-8539
Stem-loop
   uau      a   g   ag  a                c  cu 
5'    guaauu gug cgg  ua uuuccagauaaacgua gu  u
      |||||| ||| |||  || |||||||||||||||| ||   
3'    cauuaa cac gcc  au aaagguuuauuugcau ua  u
   uac      -   g   cu  c                c  ua 
Get sequence
Deep sequencing
44 reads, 1.2e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_84: 748287-748373 [+]
intergenic
Database links

Mature sequence pxy-miR-8539-5p

Accession MIMAT0033796
Sequence

18 - 

aguaauuuccagauaaacgua

 - 38

Get sequence
Deep sequencing82 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8539-3p

Accession MIMAT0033797
Sequence

53 - 

cguuuauuuggaaacuauccc

 - 73

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1