![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8540 |
|||||
Accession | MI0027390 (change log) | ||||
Description | Plutella xylostella miR-8540 stem-loop | ||||
Stem-loop |
uauu a ucu 5' auguu uauuuauuuguugacucuaaaggu a ||||| |||||||||||||||||||||||| u 3' uacaa auaaauaaacaacugagauuucca a -uuu c cuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8540 |
|
Accession | MIMAT0033798 |
Sequence |
4 - uauguuauauuuauuuguugacucua - 29 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|