Stem-loop sequence pxy-mir-8540

AccessionMI0027390 (change log)
DescriptionPlutella xylostella miR-8540 stem-loop
Stem-loop
   uauu     a                        ucu 
5'     auguu uauuuauuuguugacucuaaaggu   a
       ||||| ||||||||||||||||||||||||   u
3'     uacaa auaaauaaacaacugagauuucca   a
   -uuu     c                        cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_133: 503631-503706 [+]
intergenic
Database links

Mature sequence pxy-miR-8540

Accession MIMAT0033798
Sequence

4 - 

uauguuauauuuauuuguugacucua

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1