![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-6307 |
|||||
Accession | MI0027391 (change log) | ||||
Description | Plutella xylostella miR-6307 stem-loop | ||||
Stem-loop |
uca - c cc - cc 5' gg ggugcgggaaaagu cg uuugac gu c || |||||||||||||| || |||||| || a 3' cc ccgcguccuuuuca gc gaacug ca c gug a a uc g au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-6307 |
|
Accession | MIMAT0033799 |
Sequence |
45 - caagcucgaacuuuuccugcgc - 66 |
Deep sequencing | 17 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|