Stem-loop sequence pxy-mir-6307

AccessionMI0027391 (change log)
DescriptionPlutella xylostella miR-6307 stem-loop
Stem-loop
   uca  -              c  cc      -  cc 
5'    gg ggugcgggaaaagu cg  uuugac gu  c
      || |||||||||||||| ||  |||||| ||  a
3'    cc ccgcguccuuuuca gc  gaacug ca  c
   gug  a              a  uc      g  au 
Get sequence
Deep sequencing
19 reads, 550 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_667: 88017-88089 [+]
intergenic
Database links

Mature sequence pxy-miR-6307

Accession MIMAT0033799
Sequence

45 - 

caagcucgaacuuuuccugcgc

 - 66

Get sequence
Deep sequencing17 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1