![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-8541 |
|||||
Accession | MI0027392 (change log) | ||||
Description | Plutella xylostella miR-8541 stem-loop | ||||
Stem-loop |
ucaucugguccggggacaguucucg - a u uuca g u 5' ccaaucagcu gcc cgauuac gcg ggugc c u |||||||||| ||| ||||||| ||| ||||| | u 3' gguuagucgg cgg guuaaug cgc ccgcg g u -------------------ccuggg u a - ---- a a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-8541 |
|
Accession | MIMAT0033800 |
Sequence |
78 - uaauugaggcuggcugauuggg - 99 |
Deep sequencing | 15 reads, 3 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|