Stem-loop sequence pxy-mir-8541

AccessionMI0027392 (change log)
DescriptionPlutella xylostella miR-8541 stem-loop
Stem-loop
   ucaucugguccggggacaguucucg          -   a       u   uuca     g u 
5'                          ccaaucagcu gcc cgauuac gcg    ggugc c u
                            |||||||||| ||| ||||||| |||    ||||| | u
3'                          gguuagucgg cgg guuaaug cgc    ccgcg g u
   -------------------ccuggg          u   a       -   ----     a a 
Get sequence
Deep sequencing
29 reads, 825 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_15: 1961299-1961402 [-]
intergenic
Database links

Mature sequence pxy-miR-8541

Accession MIMAT0033800
Sequence

78 - 

uaauugaggcuggcugauuggg

 - 99

Get sequence
Deep sequencing15 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1