Stem-loop sequence pxy-mir-745

AccessionMI0027393 (change log)
DescriptionPlutella xylostella miR-745 stem-loop
Gene family MIPF0001267; mir-745
Stem-loop
   -  a     g   cg    a    cu    cuuu   u  ua 
5'  uc uguca uug  gcuc ucgu  ggca    gcu gu  a
    || ||||| |||  |||| ||||  ||||    ||| ||  u
3'  ag acagu aac  cggg agcg  ccgu    cga cg  a
   g  -     a   aa    a    au    ----   u  cu 
Get sequence
Deep sequencing
43 reads, 1.08e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_35: 502519-502599 [-]
intergenic
Database links

Mature sequence pxy-miR-745

Accession MIMAT0033801
Sequence

49 - 

uagcugccuagcgaagggcaaca

 - 71

Get sequence
Deep sequencing31 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1