Stem-loop sequence pxy-mir-8521a-5

AccessionMI0027395 (change log)
DescriptionPlutella xylostella miR-8521a-5 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   --u   cuu  g u      u  -c  --ug c    c                     - gg 
5'    ccu   gu u cguucu gu  uc    g gcgg agucagaauucgggacgagcc c  a
      |||   || | |||||| ||  ||    | |||| ||||||||||||||||||||| |   
3'    gga   ca a gcaaga ca  ag    c cguc ucaguuuuaagcccuguucgg g  g
   cuu   --u  g u      c  aa  uaaa -    -                     u gc 
Get sequence
Deep sequencing
145 reads, 3.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 933148-933265 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521a-5
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
pxy-mir-8521a-5scaffold_127: 933148-933265 [+]
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
Database links

Mature sequence pxy-miR-8521a

Accession MIMAT0033752
Sequence

66 - 

cuugucccgaauuuugacucugcc

 - 89

Get sequence
Deep sequencing502 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1