Stem-loop sequence pxy-mir-8510a-3

AccessionMI0027398 (change log)
DescriptionPlutella xylostella miR-8510a-3 stem-loop
Gene family MIPF0001886; mir-8510
Stem-loop
   ucg     a    g        c  a   -  g 
5'    ucgau cugu aucucacc gc agu cg c
      ||||| |||| |||||||| || ||| ||  
3'    aguua gaua uagagugg cg uca gu c
   gga     c    g        a  c   c  g 
Get sequence
Deep sequencing
304 reads, 7.95e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_858: 521-587 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8510a-3
pxy-mir-8510a-6scaffold_858: 134-210 [+]
pxy-mir-8510a-3scaffold_858: 521-587 [+]
pxy-mir-8510bscaffold_858: 943-1047 [+]
Database links

Mature sequence pxy-miR-8510a-5p

Accession MIMAT0033732
Sequence

9 - 

acugugaucucacccgcaagu

 - 29

Get sequence
Deep sequencing472 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8510a-3p

Accession MIMAT0033733
Sequence

41 - 

ucgcaggugagaugauagcauu

 - 62

Get sequence
Deep sequencing1715 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1