Stem-loop sequence pxy-mir-2b

AccessionMI0027399 (change log)
DescriptionPlutella xylostella miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention pxy-mir-2b
(1 sentences)

Stem-loop
   ucu    u  cuucca  aca a            c  -         c     auc    g cau 
5'    cgug gc      gg   g gcgauguggccg gc cgucaaagc gguug   auag u   u
      |||| ||      ||   | |||||||||||| || ||||||||| |||||   |||| |    
3'    gcac cg      cc   c cguuacgccggc cg guaguuucg ccgac   uauc a   g
   ucc    c  -accca  -ga -            a  a         a     -ac    g cgc 
Get sequence
Deep sequencing
249 reads, 6.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_168: 4436-4564 [-]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-2b
pxy-mir-2bscaffold_168: 4436-4564 [-]
pxy-mir-2ascaffold_168: 3771-3862 [-]
Database links

Mature sequence pxy-miR-2b

Accession MIMAT0033803
Sequence

76 - 

ucacagccagcuuugaugagcac

 - 98

Get sequence
Deep sequencing227 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1