![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pxy-mir-281 |
|||||
Accession | MI0027400 (change log) | ||||
Description | Plutella xylostella miR-281 stem-loop | ||||
Gene family | MIPF0000087; mir-46 | ||||
Literature search |
3 open access papers mention pxy-mir-281 | ||||
Stem-loop |
u a -ua c a ga 5' cuguu augaagagagc uccgu gacagu uu c ||||| ||||||||||| ||||| |||||| || c 3' ggcaa uauuucucucg aggua cuguca aa a - g uug - a au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence pxy-miR-281 |
|
Accession | MIMAT0033804 |
Sequence |
48 - ugucauggaguugcucucuuua - 69 |
Deep sequencing | 28 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24236051
"Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)"
PLoS One. 8:e78787(2013).
|