Stem-loop sequence pxy-mir-8542

AccessionMI0027401 (change log)
DescriptionPlutella xylostella miR-8542 stem-loop
Stem-loop
   uc               u          aaa 
5'   uuuuuccaucgucuc augagcaaua   a
     ||||||||||||||| ||||||||||   a
3'   aaaaagguagcagag uacucguuau   a
   uc               u          aaa 
Get sequence
Deep sequencing
3 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_148: 1640864-1640928 [+]
intergenic
Database links

Mature sequence pxy-miR-8542

Accession MIMAT0033805
Sequence

39 - 

auugcucauugagacgaugg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1