Stem-loop sequence pxy-mir-8543

AccessionMI0027402 (change log)
DescriptionPlutella xylostella miR-8543 stem-loop
Stem-loop
   uga      a           -c         u  ag 
5'    accuua aggaggaucaa  uugauaacu ag  u
      |||||| |||||||||||  ||||||||| ||   
3'    uggaau uucuucuaguu  aacuauuga uc  a
   guc      a           uc         -  ag 
Get sequence
Deep sequencing
2 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 938549-938622 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8543
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
pxy-mir-8521a-5scaffold_127: 933148-933265 [+]
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
pxy-mir-8493scaffold_127: 944000-944075 [+]
Database links

Mature sequence pxy-miR-8543

Accession MIMAT0033806
Sequence

45 - 

uuaucaacuuugaucuucuuau

 - 66

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1