Stem-loop sequence pxy-mir-2525-2

AccessionMI0027406 (change log)
DescriptionPlutella xylostella miR-2525-2 stem-loop
Gene family MIPF0002047; mir-2525
Stem-loop
   ugc        -ag g            aa    cauuuu       
5'    cagcgucc   u gcaacaguugcc  caga      gaaacc 
      ||||||||   | ||||||||||||  ||||      ||||| u
3'    gucgcagg   g uguugucaacgg  gucu      uuuugg 
   aau        aca g            cg    ------       
Get sequence
Deep sequencing
135 reads, 3.88e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_66: 628231-628316 [+]
intergenic
Database links

Mature sequence pxy-miR-2525-5p

Accession MIMAT0033809
Sequence

12 - 

aguggcaacaguugccaacaga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-2525-3p

Accession MIMAT0033810
Sequence

53 - 

ucuggcggcaacuguuguggac

 - 74

Get sequence
Deep sequencing264 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1