Stem-loop sequence pxy-mir-8544-1

AccessionMI0027407 (change log)
DescriptionPlutella xylostella miR-8544-1 stem-loop
Gene family MIPF0002007; mir-8544
   ugc  c    -  a                        acauu 
5'    gg gccg cu ugaacgcuuugugagcuacauuau     c
      || |||| || ||||||||||||||||||||||||      
3'    cc cggc ga acuugcgaaacacucgauguaaua     a
   gaa  a    u  -                        aauca 
Get sequence
Deep sequencing
37 reads, 925 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_356: 269073-269158 [+]
Database links

Mature sequence pxy-miR-8544-5p

Accession MIMAT0033811

16 - 


 - 37

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8544-3p

Accession MIMAT0033812

52 - 


 - 73

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]
