Stem-loop sequence pxy-mir-8544-2

AccessionMI0027408 (change log)
DescriptionPlutella xylostella miR-8544-2 stem-loop
Gene family MIPF0002007; mir-8544
Stem-loop
   ugc  c    -  a                        acauu 
5'    gg gccg cu ugaacgcuuugugagcuacauuau     c
      || |||| || ||||||||||||||||||||||||      
3'    cc cggc ga acuugcgaaacacucgauguaaua     a
   gaa  a    u  -                        aauca 
Get sequence
Deep sequencing
37 reads, 925 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_66: 315079-315164 [+]
intergenic
Database links

Mature sequence pxy-miR-8544-5p

Accession MIMAT0033811
Sequence

16 - 

aacgcuuugugagcuacauuau

 - 37

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-8544-3p

Accession MIMAT0033812
Sequence

52 - 

aauguagcucacaaagcguuca

 - 73

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1