Stem-loop sequence pxy-mir-8545

AccessionMI0027409 (change log)
DescriptionPlutella xylostella miR-8545 stem-loop
Stem-loop
   ugg     cuagcc     c   -  cu      ugug    g   gc     a g      c   a  uc      
5'    ugagu      uggug agg gc  ggucga    gugc ggu  accug c guggug ugc ug  gcagu 
      |||||      ||||| ||| ||  ||||||    |||| |||  ||||| | |||||| ||| ||  |||| g
3'    acuca      accac ucc cg  ccggcu    cacg ccg  uggac g caccac acg gc  cguug 
   uaa     ---uac     u   u  ac      ----    g   ac     g g      c   a  --      
Get sequence
Deep sequencing
62 reads, 1.6e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_275: 1005814-1005956 [+]
intergenic
Database links

Mature sequence pxy-miR-8545

Accession MIMAT0033813
Sequence

16 - 

ggugcagggccuggucgaug

 - 35

Get sequence
Deep sequencing62 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1