Stem-loop sequence pxy-mir-274

AccessionMI0027410 (change log)
DescriptionPlutella xylostella miR-274 stem-loop
Gene family MIPF0000264; mir-274
Stem-loop
   ugu    ga   a        -    c     cu         uagu 
5'    guua  cga guugguuu guga cguca  aacgggcag    c
      ||||  ||| |||||||| |||| |||||  |||||||||    u
3'    cagu  gcu caauuaaa cgcu guagu  uugcucguu    a
   uau    uc   -        a    a     -u         uggu 
Get sequence
Deep sequencing
102 reads, 2.68e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_240: 283528-283621 [+]
intergenic
scaffold_387: 168349-168442 [-]
intergenic
scaffold_72: 863953-864046 [+]
intergenic
Database links

Mature sequence pxy-miR-274

Accession MIMAT0033814
Sequence

19 - 

uuugugaccgucacuaacgggca

 - 41

Get sequence
Deep sequencing73 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1