Stem-loop sequence pxy-mir-8521b-6

AccessionMI0027411 (change log)
DescriptionPlutella xylostella miR-8521b-6 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   uguguuc   c   ucuc    g  gc                     - gg 
5'        guu uug    uggc cg  agucagaauucgggacaagcc c  a
          ||| |||    |||| ||  ||||||||||||||||||||| |   
3'        caa aac    accg gc  ucaguuuuaagcccuguucgg g  g
   ----gac   -   -uaa    -  --                     u gc 
Get sequence
Deep sequencing
160 reads, 4.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 919385-919480 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521b-6
pxy-mir-8521b-5scaffold_127: 916974-917079 [+]
pxy-mir-8521a-3scaffold_127: 917960-918024 [+]
pxy-mir-8521b-6scaffold_127: 919385-919480 [+]
pxy-mir-8521b-3scaffold_127: 920219-920290 [+]
pxy-mir-8521b-11scaffold_127: 921914-922002 [+]
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
Database links

Mature sequence pxy-miR-8521b

Accession MIMAT0033751
Sequence

60 - 

cuugucccgaauuuugacucggcc

 - 83

Get sequence
Deep sequencing1275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1