Stem-loop sequence pxy-mir-8521a-4

AccessionMI0027412 (change log)
DescriptionPlutella xylostella miR-8521a-4 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   uguucguucuugucuc    gu  c                    --     
5'                 uggc  gg agucagaauucgggacaagc  ccgg 
                   ||||  || ||||||||||||||||||||  ||| a
3'                 accg  uc ucaguuuuaagcccuguucg  ggcg 
   --------------ca    --  -                    cu     
Get sequence
Deep sequencing
141 reads, 3.58e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_38: 409399-409482 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521a-4
pxy-mir-8521b-3scaffold_38: 403231-403302 [+]
pxy-mir-8521a-1scaffold_38: 404173-404261 [+]
pxy-mir-8521a-4scaffold_38: 409399-409482 [+]
pxy-mir-8521a-2scaffold_38: 415393-415481 [+]
pxy-mir-8521b-3scaffold_38: 439528-439599 [+]
Database links

Mature sequence pxy-miR-8521a

Accession MIMAT0033752
Sequence

58 - 

cuugucccgaauuuugacucugcc

 - 81

Get sequence
Deep sequencing502 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1