Stem-loop sequence pxy-mir-8521b-2

AccessionMI0027417 (change log)
DescriptionPlutella xylostella miR-8521b-2 stem-loop
Gene family MIPF0001871; mir-8521
Stem-loop
   uu      ---ug  -uc    g  gc                     - gg 
5'   cguucu     uc   uggc cg  agucagaauucgggacgagcc c  a
     ||||||     ||   |||| ||  ||||||||||||||||||||| |   
3'   gcaaga     ag   accg gc  ucaguuuuaagcccuguucgg g  g
   au      ccaaa  uaa    -  --                     u gc 
Get sequence
Deep sequencing
124 reads, 3.15e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_127: 930604-930701 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-8521b-2
pxy-mir-8521b-11scaffold_127: 921914-922002 [+]
pxy-mir-8521b-7scaffold_127: 923694-923785 [+]
pxy-mir-8521b-4scaffold_127: 925344-925452 [+]
pxy-mir-8521b-9scaffold_127: 927294-927386 [+]
pxy-mir-8521b-8scaffold_127: 929984-930055 [+]
pxy-mir-8521b-2scaffold_127: 930604-930701 [+]
pxy-mir-8521a-5scaffold_127: 933148-933265 [+]
pxy-mir-8521b-10scaffold_127: 934840-934904 [+]
pxy-mir-8521b-1scaffold_127: 936871-936942 [+]
pxy-mir-8543scaffold_127: 938549-938622 [+]
Database links

Mature sequence pxy-miR-8521b

Accession MIMAT0033751
Sequence

56 - 

cuugucccgaauuuugacucggcc

 - 79

Get sequence
Deep sequencing1275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1