Stem-loop sequence pxy-mir-2767

AccessionMI0027420 (change log)
DescriptionPlutella xylostella miR-2767 stem-loop
Gene family MIPF0001446; mir-2767
Stem-loop
   uuu              uc   u      c u   g   c  uu 
5'    auuucguagucguc  aag aaaucu g gcg cug ug  u
      ||||||||||||||  ||| |||||| | ||| ||| ||  c
3'    uaagguaucaguag  uuc uuuaga c cgc gac ac  a
   ccu              uc   c      u u   g   -  cu 
Get sequence
Deep sequencing
99 reads, 2.75e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_307: 172049-172138 [-]
intergenic
Database links

Mature sequence pxy-miR-2767

Accession MIMAT0033818
Sequence

19 - 

caaguaaaucucgugcggcug

 - 39

Get sequence
Deep sequencing97 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1