Stem-loop sequence atr-MIR8551

AccessionMI0027425 (change log)
DescriptionAmborella trichopoda miR8551 stem-loop
Stem-loop
          -  c      cg  a       cu     u      a     aua  u       a          cg             aaaaaguucuagaacacuuuugaaauuuccggaacaacuuuuaugacuuggaaacuguuaa 
5' gggucua gu aucuuc  ga aguauuc  agguu gaaggg guuua   gg caaaaug guccaagagc  accuagaacaucc                                                             c
   ||||||| || ||||||  || |||||||  ||||| |||||| |||||   || ||||||| ||||||||||  |||||||||||||                                                              
3' uccaggu ca uagaag  uu uuauaag  uccga cuuucc caaau   cc guuuugu uagguucucg  uggaucuuguagg                                                             g
          a  -      au  c       au     u      -     cgc  c       g          au             guaauuaaagaccuuucgggguuuuguaagguuuuaaaagacuuuuuaaaauacugucaca 
Get sequence
Deep sequencing
744 reads, 250 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00002: 4164864-4165160 [+]
intergenic
Database links

Mature sequence atr-miR8551

Accession MIMAT0033822
Sequence

214 - 

auguucuagguuagcucuuggaug

 - 237

Get sequence
Deep sequencing489 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).