Stem-loop sequence atr-MIR8552a

AccessionMI0027426 (change log)
DescriptionAmborella trichopoda miR8552a stem-loop
Gene family MIPF0001863; MIR8552
Stem-loop
                                    u     c               a     a                             a          a  -aa     g    a   a      c ug    c        g       caaaaa      -a     c         caa           ucaagua     -uu              c   a 
5' gcugagauuagccuacuagcucaugugaauaua gagcc aacgaccuagauuga ucugg uugaucugacggucaugaccucauuuugu uuugaauuuu au   uuuuu uacg auc aaauaa u  aaau uuaggugu uguucuu      uaggau  aucua uaaaaauau   aaaaauaauuu       auaaa   gaucaaaauacucu gaa c
   ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||| ||   ||||| |||| ||| |||||| |  |||| |||||||| |||||||      ||||||  ||||| |||||||||   |||||||||||       |||||   |||||||||||||| |||  
3' cgacuuuaaucgggugaucgaguauacuuguau cucgg uuguugggucuaauu agauc gacuagacugccagugcuggaguaaagca aaacuuaaaa ua   aaaaa augu uag uuuauu a  uuua aauucaca guaagaa      guucug  uggau auuuuuaua   uuuuuauuaag       uauuu   cugguuuuauggga cuu g
                                    -     a               -     g                             c          c  aaa     a    g   g      a gu    a        g       -uagua      cg     u         aaa           -------     uuu              a   u 
Get sequence
Deep sequencing
2665 reads, 4.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 8707919-8708369 [+]
intergenic
Database links

Mature sequence atr-miR8552a

Accession MIMAT0033823
Sequence

364 - 

cgaaaugaggucgugaccgucaga

 - 387

Get sequence
Deep sequencing2042 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).