Stem-loop sequence atr-MIR8553a

AccessionMI0027427 (change log)
DescriptionAmborella trichopoda miR8553a stem-loop
Gene family MIPF0001864; MIR8553
Stem-loop
                             -            c                                      c   uu       a          g                        cug         a         g         c ua      g    ga         ua    a  gg      aauaaaaaaauauuuccuaaaauauaaacugauugaaauacccugaaaaauaau 
5' auguauguguauguguauauauauau ggaaaaagauuu cuaagcuacuagcuauaaugaauaguauaagcuacuag ucu  gcuguca aucuucaucg gugguucagaauucauaucacuau   aauuuuaau uuuuuucua aaaucagau g  augaaa uuug  uguguguau  aaca ua  gcgcac                                                      g
   |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||  ||||||| |||||||||| ||||||||||||||||||||||||   ||||||||| ||||||||| ||||||||| |  |||||| ||||  |||||||||  |||| ||  ||||||                                                       
3' uauauauauauauauauauauauaua ccuuuuucuaaa gauucgaugaucgauauuacuuauuauauucgaugauc agg  uggcagu uagaaguagc caccaaguuuuaaguauagugaua   uuaaaauua aaaaaagau uuuaguuua u  uacuuu aaac  acauauaug  uugu au  cgcgug                                                      g
                             u            a                                      a   gu       c          g                        aaa         c         a         a uc      a    uc         ga    g  aa      gcauauuuuuauauuuuguuaaugaagguuauuaaauuuuacugguuuaauggg 
Get sequence
Deep sequencing
3356 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00008: 2573268-2573780 [+]
intergenic
Database links

Mature sequence atr-miR8553a

Accession MIMAT0033824
Sequence

98 - 

aucgggugguucagaauucauauc

 - 121

Get sequence
Deep sequencing482 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).