Stem-loop sequence atr-MIR8554

AccessionMI0027428 (change log)
DescriptionAmborella trichopoda miR8554 stem-loop
Stem-loop
                            -auuua       a   auaua  -  ug     a      u      u  uuc    u       uu a       a   uu      u                        ug      c    ua  cg       ug  u         caa        c   caacug      -uuuaa      a        g               u      c                    a    ucaaaauaua         u  a        ag  c                         uauu  -  u ag   u 
5' gaaauuuaugcucaugucccccuaa      uguuauu aaa     cc cc  aaaau uuguau uuaugu ca   gccu uuuuauu  u uuuauuu uuu  caaaau gucucacuucggaccuucaagguu  aaguca aauu  ug  augacuu  ga cuugaggau   aaguaauu uuu      auggcu      cuuuga gauucgaa uuaucuuuuggcuuc gaccuu aaggucugaagucaagauuc uguc          ggucuuggc uu gaccuuca  gu cgaagccaaagacuuuaaaaaaauu    gg cu u  uag u
   |||||||||||||||||||||||||      ||||||| |||     || ||  ||||| |||||| |||||| ||   |||| |||||||  | ||||||| |||  |||||| ||||||||||||||||||||||||  |||||| ||||  ||  |||||||  || |||||||||   |||||||| |||      ||||||      |||||| |||||||| ||||||||||||||| |||||| |||||||||||||||||||| ||||          ||||||||| || ||||||||  || |||||||||||||||||||||||||    || || |  ||| a
3' cuuuaaauacgaguacagggggauu      acaauaa uuu     gg gg  uuuua ggcaua aaugca gu   uggg aaaauag  g agauaaa aga  guuuua cggggugaagucuggaaguuuuag  uuuagu uuaa  ac  uacugag  cu gaacuucua   uuuauuaa aaa      uacuga      gaagcu cuagguuu aguagagaaccgaag cuggaa uucuagacuuuaguucugag auag          uuagaaccg aa cuggaagu  ca gcuucgguuucugaaguuuuuuuaa    uc ga a  auc u
                            auuaag       a   gcuaa  a  --     c      u      -  -uc    u       uu a       -   gg      -                        gu      a    ca  aa       gu  u         aac        c   aauuaa      cgucug      -        a               u      c                    c    ----------         u  c        cu  u                         --cu  a  u gg   u 
Get sequence
Deep sequencing
3133 reads, 2.32e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00009: 5608266-5608953 [+]
intergenic
Database links

Mature sequence atr-miR8554

Accession MIMAT0033825
Sequence

153 - 

ugcgaugacuuuggaucuugagga

 - 176

Get sequence
Deep sequencing1177 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).