Stem-loop sequence atr-MIR8555

AccessionMI0027429 (change log)
DescriptionAmborella trichopoda miR8555 stem-loop
Stem-loop
   aguuggggagagacuugcugcugacgaucuuuauuguuuuuagauuuuauuuuauauuu         a                                              g  ccu  c   ga         uaguau 
5'                                                            ucaucuuca gcaacauacaccacggggccuuauccuguagaugucuaguuaacuc uu   aa caa  caaagaggu      u
                                                              ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||   || |||  |||||||||      g
3'                                                            aguaggagu uguuguaugugguguuccggaguaggauaucuacggaucaauugag ag   uu guu  guuucucua      a
   --------ucaagauuuaaacacaaauaugguagagauuagaauaauuaguuuugauac         g                                              g  auu  a   uc         uaccug 
Get sequence
Deep sequencing
4229 reads, 1.15e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00011: 6531643-6531925 [+]
intergenic
Database links

Mature sequence atr-miR8555

Accession MIMAT0033826
Sequence

178 - 

aguuaacuaggcaucuauaggaug

 - 201

Get sequence
Deep sequencing2600 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).