Stem-loop sequence atr-MIR8556

AccessionMI0027430 (change log)
DescriptionAmborella trichopoda miR8556 stem-loop
Stem-loop
          c                ua     u        u                                       gauuguagaauuacaauaaaggaaagagugaagagagagaaaacgaucaacacgacauauauguggu 
5' gaguuuc uauuuugugggauuac  uugua ugagauuu guuuccuaaaagacaggaauuguaacucuauaaaucuuu                                                                   u
   ||||||| ||||||||||||||||  ||||| |||||||| |||||||||||||||||||||||||||||||||||||||                                                                    
3' cuuaaag auaaaacaccuuaaug  aacau auuuuaaa caaaggauuuucuguucuuagcauugagauguuuagaga                                                                   c
          u                uc     u        -                                       ucauuugaucucguuaggguuacuuacucuaugaccaaaugggagguaucugcauccguaguaaggg 
Get sequence
Deep sequencing
459 reads, 500 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00013: 1587032-1587326 [+]
intergenic
Database links

Mature sequence atr-miR8556

Accession MIMAT0033827
Sequence

48 - 

uaaaagacaggaauuguaacu

 - 68

Get sequence
Deep sequencing332 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).