Stem-loop sequence atr-MIR8553b

AccessionMI0027431 (change log)
DescriptionAmborella trichopoda miR8553b stem-loop
Gene family MIPF0001864; MIR8553
Stem-loop
           a   u                        c   c                              a     au           a   a          a     aa          ggguguauauacuuaacacccuugugcaucauauaaaaauauaaaaaaauacuuuucagaauuaaaaauuaccaaauuacc 
5' caccuaua uga uaguaauauagguggaaucccagc guc gaucuuuaucgggugguucaaaauacaugu acuau  gaauuuuaauc uuu uuuagaaauc gauug  augaaauuuu                                                                                 c
   |||||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||  ||||||||||| ||| |||||||||| |||||  ||||||||||                                                                                  
3' guggauau acu auuauuauauccaccuuagggucg cag cuagaaguaguccaccagguuuuauguaua ugaua  cuugaaauuag aaa aaaucuuuag cuagc  uacuuuaaaa                                                                                 c
           -   u                        u   a                              g     gu           a   a          a     ac          cucguacacaugauuuuuauccauuauguucuuuauuauaucuuauuauagaagguuuuauauauagggacuguuuacuac 
Get sequence
Deep sequencing
2034 reads, 1.1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00013: 3157565-3157975 [-]
intergenic
Database links

Mature sequence atr-miR8553b

Accession MIMAT0033828
Sequence

344 - 

uguauuuuggaccaccugaugaag

 - 367

Get sequence
Deep sequencing1645 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).