Stem-loop sequence atr-MIR8557

AccessionMI0027432 (change log)
DescriptionAmborella trichopoda miR8557 stem-loop
Stem-loop
          gc   g       a   ccauuuuagagcaucacauauggguucuuaauccuug 
5' uaggguc  uuu uaacugu ugg                                     a
   |||||||  ||| ||||||| |||                                      
3' guuucgg  aag guugaua acc                                     u
          aa   g       a   ucaaccuauguauuuaggaccaggcgcuaagacgaga 
Get sequence
Deep sequencing
554 reads, 1.88e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00016: 725142-725265 [+]
intergenic
Database links

Mature sequence atr-miR8557

Accession MIMAT0033829
Sequence

101 - 

ccaaauaguugggaaaaggcu

 - 121

Get sequence
Deep sequencing413 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).