Stem-loop sequence atr-MIR8558a

AccessionMI0027433 (change log)
DescriptionAmborella trichopoda miR8558a stem-loop
Stem-loop
        aau      ac     a  u  ug   u          u g    -           a       ggcuu    auu 
5' gguuu   ggugga  augga ag gg  ugg agccgggggu u aggu ugggcggguuc ggaaggc     uuau   c
   |||||   ||||||  ||||| || ||  ||| |||||||||| | |||| ||||||||||| |||||||     ||||    
3' ucgag   ccaccu  uacuu uc cc  auc ucggccuuca a ucca auccgccuaag ccuuucg     aaug   a
        --c      ga     c  -  cu   u          u g    u           -       auccc    auu 
Get sequence
Deep sequencing
73273 reads, 2.23e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00017: 2901029-2901189 [+]
intergenic
Database links

Mature sequence atr-miR8558a

Accession MIMAT0033830
Sequence

98 - 

uuuccgaauccgccuauaccug

 - 119

Get sequence
Deep sequencing72847 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).