Stem-loop sequence atr-MIR8559

AccessionMI0027434 (change log)
DescriptionAmborella trichopoda miR8559 stem-loop
Stem-loop
   ua              -u     u   u   auca         cga               a    c          a   c    -      ug -   c 
5'   uauauauauauaua  gggaa gga ccu    gcccacggg   acugcuacaguguca ccaa gguccagauu aau uggg ccgauc  a ggu g
     ||||||||||||||  ||||| ||| |||    |||||||||   ||||||||||||||| |||| |||||||||| ||| |||| ||||||  | |||  
3'   auauauauauauau  uccuu cuu gga    cgggugccc   ugaugaugucacagu gguu ccggguuuaa uua accc ggcuag  u cca u
   --              cu     u   c   caaa         aac               c    u          c   u    a      gu a   g 
Get sequence
Deep sequencing
1013 reads, 1.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00017: 4559611-4559811 [-]
intergenic
Database links

Mature sequence atr-miR8559

Accession MIMAT0033831
Sequence

142 - 

ugacacuguaguagucaacccgug

 - 165

Get sequence
Deep sequencing667 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).