Stem-loop sequence atr-MIR8617

AccessionMI0027435 (change log)
DescriptionAmborella trichopoda miR8617 stem-loop
Stem-loop
   -------------gcguugguaaucauaaa       u       gggguc    c           au      c               a  u       a          g                  a   -     uu   aua      a 
5'                               aauuagu aaggggu      uaua aagguuguagc  uacuug agaaguaagguugcg ug ucuacau guucauuuua uuggaugguguagauuua cac gucuu  aag   guguca a
                                 ||||||| |||||||      |||| |||||||||||  |||||| ||||||||||||||| || ||||||| |||||||||| |||||||||||||||||| ||| |||||  |||   |||||| a
3'                               uugauua uuuuuca      auau uuccaacguug  augaac ucuucauucuaacgu au agaugua uaaguaaaau aacuugucacaucuaaau gug uagaa  uuc   cauagu a
   uguuuucuaauaguaaaacgaaaauaagaa       -       -----a    a           gc      a               c  u       g          a                  c   a     uu   -cg      g 
Get sequence
Deep sequencing
1855 reads, 1.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00018: 135389-135684 [-]
intergenic
Database links

Mature sequence atr-miR8617

Accession MIMAT0033832
Sequence

93 - 

ucauuuuaguuggaugguguagau

 - 116

Get sequence
Deep sequencing1557 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).