Stem-loop sequence atr-MIR8560

AccessionMI0027436 (change log)
DescriptionAmborella trichopoda miR8560 stem-loop
Stem-loop
   u   -   g  -g ug   -c   uau     gaauca     cc   cu  uauau                             a                                   c   a          -ac   aaagaaaaaua 
5'  cgc uag uu  c  agu  caa   gccuu      ugaag  gaa  gg     aggccagguuacauagauccacuuuaaac cucagccugcgcuaauucaccuaguaaggauuucc ucc aaacacgaag   aac           c
    ||| ||| ||  |  |||  |||   |||||      |||||  |||  ||     ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||   |||           a
3'  gug guu ag  g  ucg  guu   uggag      acuuc  uuu  uu     uuuggucuaauguaucuaggugaaauuug gagucggacgugauuaaguggaucauuccuaaagg agg uuugugcuuc   uug           a
   g   u   g  aa gu   uc   --u     aaauug     uu   uu  ----u                             a                                   -   c          gac   accauagauug 
Get sequence
Deep sequencing
1494 reads, 5.35e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00002: 6347799-6348098 [-]
intergenic
Database links

Mature sequence atr-miR8560

Accession MIMAT0033833
Sequence

72 - 

uccacuuuaaacacucagccu

 - 92

Get sequence
Deep sequencing782 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).