Stem-loop sequence atr-MIR8561

AccessionMI0027437 (change log)
DescriptionAmborella trichopoda miR8561 stem-loop
Stem-loop
       aaua     u   u        u    c           a   gc                               a   -   a  cg  guau       cua 
5' aggc    acaau uca ggacuagc ccaa uguuuuuguua gcu  aauuaaugugugacauuguugucggcucacu cua guu uu  au    augggga   a
   ||||    ||||| ||| |||||||| |||| ||||||||||| |||  ||||||||||||||||||||||||||||||| ||| ||| ||  ||    |||||||   c
3' ucug    uguua agu ucugaucg gguu acaagaacaau cgg  uuaauuacacacuguaauaacagucgaguga ggu caa ag  ua    uauccuu   a
       ---c     c   u        u    a           c   ua                               c   u   c  au  auuc       ccu 
Get sequence
Deep sequencing
15669 reads, 4.25e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00019: 4756003-4756219 [-]
intergenic
Database links

Mature sequence atr-miR8561.1

Accession MIMAT0033834
Sequence

60 - 

ugacauuguugucggcucacuacu

 - 83

Get sequence
Deep sequencing12173 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence atr-miR8561.2

Accession MIMAT0033835
Sequence

155 - 

aaugucacacauuaauuauggccu

 - 178

Get sequence
Deep sequencing2648 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).