Stem-loop sequence atr-MIR8562a

AccessionMI0027438 (change log)
DescriptionAmborella trichopoda miR8562a stem-loop
Gene family MIPF0001861; MIR8562
Stem-loop
           c           c         cua              caaag                a                        aau             a                          auguauucauuaaaaauaagcaaaacuaggaaaaauauaaaaaaaaaaaauuacaugaaauaaauugaccaaaauaccaucgaaa 
5' ccuauagg gaaaaugaaca ugauuucgc   cccucaucaccguc     uucaucgcacggucac auuguuugguaguguuucauuuuu   uuuuuuuuuuuac aaucggaaugaucugaaauuuggagc                                                                                     a
   |||||||| ||||||||||| |||||||||   ||||||||||||||     |||||||||||||||| ||||||||||||||||||||||||   ||||||||||||| ||||||||||||||||||||||||||                                                                                      
3' ggauaucc cuuuuacuugu acuaaagcg   gggaguaguggcag     aaguagcgugccagug uaacaagccauuacaaaguaaaaa   aaaaaaaaagaug uuagccuuacuagauuuuaaaccuug                                                                                     g
           u           c         aac              auaua                c                        -gu             c                          cacacauguagaaucacucugcguggauuacuuuuauauuuuguuuauuaagugcuuuuguuuuaacugguuuuaugggaacucu 
Get sequence
Deep sequencing
20899 reads, 1.84e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00020: 3302096-3302538 [+]
intergenic
Database links

Mature sequence atr-miR8562a

Accession MIMAT0033836
Sequence

113 - 

ucggaaugaucugaaauuuggagc

 - 136

Get sequence
Deep sequencing12936 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).