Stem-loop sequence atr-MIR8562b

AccessionMI0027439 (change log)
DescriptionAmborella trichopoda miR8562b stem-loop
Gene family MIPF0001861; MIR8562
Stem-loop
      g   a     a    a              ccuaccc                a      c                gau    -      uuuuua                                    c  a   u   aaaaaaua    ---     cg        ca        u  u   u                    a   gaaaa 
5' aac ccu uaggu aaaa gaacagugauuucg       ucaucaccguccaaag ucaucg auggucacgauugucu   agug uuucau      uuuuuucuacaaaucggaaugaucugaaauuuggag gu ugu cau        ggga   aucua  aaaaauau  aaaaaaua uu aca gaaauaaauugaccaaaaua ucc     a
   ||| ||| ||||| |||| ||||||||||||||       |||||||||||||||| |||||| ||||||||||||||||   |||| ||||||      |||||||||||||||||||||||||||||||||||| || ||| |||        ||||   |||||  ||||||||  |||||||| || ||| |||||||||||||||||||| |||     g
3' uug gga aucca uuuu cuugucauuaaagc       aguaguggcagguuuc aguagc ugccagugcuaacaga   ucau aaagua      aaaaaagauguuuagccuuacuagacuuuaaaccuc ca aca gua        cucu   uggau  uuuuuaua  uuuuuuau aa ugu uuuuauuuaacugguuuuau agg     u
      g   a     c    a              -aauaca                a      a                ---    u      -----c                                    a  c   u   --aaauca    gcg     ua        ua        u  u   u                    -   aacuu 
Get sequence
Deep sequencing
23377 reads, 2.16e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00053: 1878662-1879096 [+]
intergenic
Database links

Mature sequence atr-miR8562b

Accession MIMAT0033837
Sequence

113 - 

ucggaaugaucugaaauuuggagc

 - 136

Get sequence
Deep sequencing14838 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).