Stem-loop sequence atr-MIR8562c

Accession

MI0027440 (change log)

Description

Amborella trichopoda miR8562c stem-loop

Gene family

MIPF0001861; MIR8562

Stem-loop

         ga     cuaa    u               u             a                    c      u   aaaaaau  -      c           uaaaaauaaauagacuaaaauuccucugaaaauuuguga 
5' cgguca  guugu    uagu uuuuaauuuuuauuu uuuucuauaaauc gaaugaucugaaauuuggag gugugu cau       ag gauaau uaauaaaaaua                                       g
   ||||||  |||||    |||| ||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||| |||       || |||||| |||||||||||                                        
3' gccagu  uaaca    auca aaaguuaaaaauaaa aaaagauauuuag cuuacuagacuuuaaaccuc cgcaca gua       uc cuguua auuauuuuuau                                       a
         gc     ugcg    u               c             c                    a      u   gaaucac  u      -           acuuuuuuuuuuaaaguuuuauauuuaacugguuuuaug 

Deep sequencing

6853 reads, 8.75e+03 reads per million, 4 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (AmTr_v1.0): scaffold00221: 34564-34863 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0027440

Mature sequence atr-miR8562c

• Accession: MIMAT0033838
• Sequence: 50 - ucagaaugaucugaaauuuggagc - 73
• Deep sequencing: 4599 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).