Stem-loop sequence atr-MIR8562c

AccessionMI0027440 (change log)
DescriptionAmborella trichopoda miR8562c stem-loop
Gene family MIPF0001861; MIR8562
Stem-loop
         ga     cuaa    u               u             a                    c      u   aaaaaau  -      c           uaaaaauaaauagacuaaaauuccucugaaaauuuguga 
5' cgguca  guugu    uagu uuuuaauuuuuauuu uuuucuauaaauc gaaugaucugaaauuuggag gugugu cau       ag gauaau uaauaaaaaua                                       g
   ||||||  |||||    |||| ||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||| |||       || |||||| |||||||||||                                        
3' gccagu  uaaca    auca aaaguuaaaaauaaa aaaagauauuuag cuuacuagacuuuaaaccuc cgcaca gua       uc cuguua auuauuuuuau                                       a
         gc     ugcg    u               c             c                    a      u   gaaucac  u      -           acuuuuuuuuuuaaaguuuuauauuuaacugguuuuaug 
Get sequence
Deep sequencing
6853 reads, 8.75e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00221: 34564-34863 [+]
intergenic
Database links

Mature sequence atr-miR8562c

Accession MIMAT0033838
Sequence

50 - 

ucagaaugaucugaaauuuggagc

 - 73

Get sequence
Deep sequencing4599 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).