Stem-loop sequence atr-MIR8563

AccessionMI0027441 (change log)
DescriptionAmborella trichopoda miR8563 stem-loop
Stem-loop
   u                       gac    g   gau             aaauac        c ag            c  c         u         c                     --               c   c c    auaac     uc         a      a g        a  g                 a         caag 
5'  uguaauuuguggaacauuaauua   agau aaa   gcaacaugaaaug      aaggaaaa g  aucaucgucauc au aauuuccuu gcuuuugcc uuuuccacuuaguuucuugua  cgcaugcuauguuaa ucu c ucgc     uguau  auuaacucc uacucu a cuguuaga uu cuacauuccauguggcu gacgaauuc    a
    |||||||||||||||||||||||   |||| |||   |||||||||||||      |||||||| |  |||||||||||| || ||||||||| ||||||||| |||||||||||||||||||||  ||||||||||||||| ||| | ||||     |||||  ||||||||| |||||| | |||||||| || ||||||||||||||||| |||||||||     
3'  auauuaaacauuuuguaauuaau   ucua uuu   uguuguacuuuau      uuccuuuu c  uaguaguaguag ua uuaaaggaa cgaaaacgg gaaaggugaauuaaaggauau  guguaugauacaauu aga g agcg     acaua  ugauugagg augaga u gacaaucu aa gauguaagguacacuga cuguuuagg    g
   a                       auc    a   auu             -----a        a gu            a  a         u         a                     cc               a   u a    gagua     ga         c      a g        c  g                 g         auaa 
Get sequence
Deep sequencing
2544 reads, 1.7e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00021: 1174892-1175342 [-]
intergenic
Database links

Mature sequence atr-miR8563

Accession MIMAT0033839
Sequence

170 - 

cuccauacucuaagcuguuagaau

 - 193

Get sequence
Deep sequencing1339 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).