Stem-loop sequence atr-MIR8564

AccessionMI0027442 (change log)
DescriptionAmborella trichopoda miR8564 stem-loop
Stem-loop
           cgaaa                     a                          uc    a     c    cc    cg      -    cuccauuuc                         u   c       -------u   -      uuu 
5' uauauaua     aaagcugggauuagcucacua uucauaugaacauaugaguccaacgg  caga ugaau uggg  gauc  acgguc ucga         guguuugaauuuuaauuuuuuuuuu aca auccaaa        cau uugaug   u
   ||||||||     ||||||||||||||||||||| ||||||||||||||||||||||||||  |||| ||||| ||||  ||||  |||||| ||||         ||||||||||||||||||||||||| ||| |||||||        ||| ||||||   u
3' auauauau     uuucgauccuaauugggugau gaguauacuuguauacucggguuguc  guuu acuua acuu  cuag  ugcuag agcu         cacaaacuuaaaauuaaaaaaaaga ugu uagguuu        gug aacuac   u
           auaua                     c                          ga    a     u    aa    au      u    acaagcuau                         -   u       uaacucau   g      uuu 
Get sequence
Deep sequencing
1993 reads, 3.98e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00021: 1421188-1421508 [+]
intergenic
Database links

Mature sequence atr-miR8564

Accession MIMAT0033840
Sequence

259 - 

agcuguugggcucauauguucaua

 - 282

Get sequence
Deep sequencing215 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).