Stem-loop sequence atr-MIR8565g

AccessionMI0027443 (change log)
DescriptionAmborella trichopoda miR8565g stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
                                                       u   ca            gu         -cau        ----     u 
5' agaguaaugauccugugagauccuuccacacccauguguguaggauuccaaa gau  ccauuaaauuug  acaaauuuu    aaaaguua    ucaca g
   |||||||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||||||||  |||||||||    ||||||||    |||||  
3' ucucauuacuaggauacuuugggaggguguggguacacacauucuaggguuu cua  gguaauuuaaac  uguuuagag    uuuucagu    ggugu g
                                                       u   ua            ug         auuu        ucag     g 
Get sequence
Deep sequencing
5011 reads, 3.4e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00023: 5789125-5789327 [-]
intergenic
Database links

Mature sequence atr-miR8565g

Accession MIMAT0033841
Sequence

33 - 

cauguguguaggauuccaaaugau

 - 56

Get sequence
Deep sequencing4422 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).