Stem-loop sequence atr-MIR8566

AccessionMI0027444 (change log)
DescriptionAmborella trichopoda miR8566 stem-loop
Stem-loop
   uca           a                    c  gaa          u    ucu      -  -    g a     gacccaagguauaaaaaauaaucucuuccaagaaguaccaaaaagauauggggacuuauggccucauug 
5'    acaucuccacu uguccauucagcucuaauuc au   caacaucuuc uuaa   cuaauu uc ucau g uuauc                                                                     u
      ||||||||||| |||||||||||||||||||| ||   |||||||||| ||||   |||||| || |||| | |||||                                                                      
3'    uguagagguga guaggugggucgagauuaag ua   guuguagaag aguu   gguuag ag agua u aguag                                                                     g
   -ag           a                    a  acc          u    --u      u  u    g -     uaguaucggaaaaggauuaauuaacccagucgauguguuuagaaccagacgaaauaauuucugguaugg 
Get sequence
Deep sequencing
3677 reads, 3.59e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00024: 74289-74584 [-]
intergenic
Database links

Mature sequence atr-miR8566

Accession MIMAT0033842
Sequence

265 - 

auuagagcuggguggaugaagugg

 - 288

Get sequence
Deep sequencing155 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).