Stem-loop sequence atr-MIR8567

AccessionMI0027445 (change log)
DescriptionAmborella trichopoda miR8567 stem-loop
Stem-loop
      a      a        a       ga   -     ---    auaagcacuuaaaaau 
5' gaa uuuagg uuuuaaaa uggugca  uug agcag   aucu                c
   ||| |||||| |||||||| |||||||  ||| |||||   ||||                 
3' cuu aaguuc aggauuuu aucacgu  aac uuguu   uaga                u
      a      -        a       ag   a     caa    ccugguagauaaaagu 
Get sequence
Deep sequencing
3314 reads, 1.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00024: 566615-566733 [+]
intergenic
Database links

Mature sequence atr-miR8567

Accession MIMAT0033843
Sequence

88 - 

acaagaugcacuaauuuuaggacu

 - 111

Get sequence
Deep sequencing2908 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).