Stem-loop sequence atr-MIR8568

AccessionMI0027446 (change log)
DescriptionAmborella trichopoda miR8568 stem-loop
Stem-loop
   guauugc     - -     c     ---      -ca    -uu g       gacgagagacuucagaaagaggaauucaauaggacaaggaucgcguaagccaagacggacagcaaauu 
5'        uugcg c cacca uggga   acuucu   cucu   a cgcccuu                                                                    u
          ||||| | ||||| |||||   ||||||   ||||   | |||||||                                                                    u
3'        aaugc g guggu accuu   ugagga   gagg   u gugggaa                                                                    a
   ----caa     u u     u     agg      cua    ugu g       gcgauugguaaacaaccuacgguaccuguugcuagugucauucgguucuaccuugucguaccacuagu 
Get sequence
Deep sequencing
1036 reads, 500 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00024: 4164779-4165014 [-]
intergenic
Database links

Mature sequence atr-miR8568

Accession MIMAT0033844
Sequence

141 - 

uggcuuacugugaucguugucc

 - 162

Get sequence
Deep sequencing628 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).