Stem-loop sequence atr-MIR8569

AccessionMI0027447 (change log)
DescriptionAmborella trichopoda miR8569 stem-loop
Stem-loop
              au           -      ca            uuu -u  gu  a   ca       a            a       uu    c  c   c    u  a    ua      ga   g            uac    uc         c  g     ugaa    c    c      c  c          gu u   ca       a   u        c    a   -accg   a 
5' aagaaaaauaa  augauaguuua aaauau  aauauguuagaa   g  uu  ca uuu  uuuagcc guugaacugguu aaaccgg  gguc aa ugg caaa uu guca  aacauu  uuu gauugguuuuuu   cgaa  uaguuuuua uu aggcc    cagc aaag accagu ga ggucugaccg  c gau  ccaguuc gua guucuuga cacu uag     aag a
   |||||||||||  ||||||||||| ||||||  ||||||||||||   |  ||  || |||  ||||||| |||||||||||| |||||||  |||| || ||| |||| || ||||  ||||||  ||| ||||||||||||   ||||  ||||||||| || |||||    |||| |||| |||||| || ||||||||||  | |||  ||||||| ||| |||||||| |||| |||     ||| a
3' uucuuuuuauu  uauuauuaaau uuuaua  uuauauaaucuu   c  aa  gu aaa  aaaucgg uaacuugaucaa uuuggcu  ucag uu acc guuu ag uagu  uuguga  gaa cuagccaaaaag   guuu  guuaaaaau ag ucugg    guug uuuc ugguca cu ccaggcuggc  g cua  ggucaag cau caagaacu gugg auc     uuc g
              --           a      ua            uuu uc  ug  -   ac       c            c       gu    u  a   a    u  a    --      ac   a            --u    ga         u  a     uuug    u    c      u  a          ug u   ac       c   u        a    a   aauaa   u 
Get sequence
Deep sequencing
12413 reads, 3.45e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00024: 6186109-6186603 [+]
intergenic
Database links

Mature sequence atr-miR8569

Accession MIMAT0033845
Sequence

285 - 

acuggcaaucuggucggucggacc

 - 308

Get sequence
Deep sequencing5755 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).