Stem-loop sequence atr-MIR8565a

AccessionMI0027448 (change log)
DescriptionAmborella trichopoda miR8565a stem-loop
Gene family MIPF0001889; MIR8565
Stem-loop
              a a u     u   -au        c                             u                       c             ----     u 
5' uauauauauau g g aauga ccu   gagacuuu ccacacccauguguguaggaccucaaagg ucaccauuaaauuuggcacagau ucuagaaaaguua    ucaca g
   ||||||||||| | | ||||| |||   |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||    |||||  
3' auauauauaua c c uuacu gga   cucuggga gguguggguacacacauccugggguuucc aguggugauuuaaaccgugucua agaucuuuucagu    ggugu g
              c - u     -   acu        a                             u                       u             ucag     g 
Get sequence
Deep sequencing
10734 reads, 4.72e+03 reads per million, 4 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00025: 1560375-1560597 [-]
intergenic
Database links

Mature sequence atr-miR8565a

Accession MIMAT0033846
Sequence

79 - 

uuggcacagaucucuagaaaaguu

 - 102

Get sequence
Deep sequencing7275 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).